Product Details

SNP ID: rs10900552
Assay Type: Functionally tested
NCBI dbSNP Submissions: 46
Location: Chr.1:204135008 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: CTAAGCCAGAGGTTAGGCTTAATGG[C/T]CAGTGGGGGGCTGGAGCCTCTCAGG
Phenotype: MIM: 609859 MIM: 604748
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: ETNK2 PubMed Links

Gene Details

Gene: ETNK2
Gene Name: ethanolamine kinase 2

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001297760.1		Intron			NP_001284689.1
NM_001297761.1		Intron			NP_001284690.1
NM_001297762.1		Intron			NP_001284691.1
NM_018208.3		Intron			NP_060678.2
XM_011509714.2		Intron			XP_011508016.1
XM_011509715.1		Intron			XP_011508017.1
XM_017001632.1		Intron			XP_016857121.1

Gene: LOC101929441
Gene Name: uncharacterized LOC101929441

There are no transcripts associated with this gene.

Gene: SOX13
Gene Name: SRY-box 13

There are no transcripts associated with this gene.

View Full Product Details