Product Details

SNP ID: rs12407073
Assay Type: Functionally tested
NCBI dbSNP Submissions: 17
Location: Chr.1:155320781 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CCAGGACCCAGGGGCCAAAAGCTTA[G/T]GATATATCAAACCCTCTAGGTGGGT
Phenotype: MIM: 134629
Polymorphism: G/T, Transversion substitution
Allele Nomenclature
Literature Links: FDPS PubMed Links

Gene Details

Gene: FDPS
Gene Name: farnesyl diphosphate synthase

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001135821.1	985	Intron			NP_001129293.1
NM_001135822.1	985	Intron			NP_001129294.1
NM_001242824.1	985	Intron			NP_001229753.1
NM_001242825.1	985	Intron			NP_001229754.1
NM_002004.3	985	Intron			NP_001995.1
XM_005244962.1	985	Intron			XP_005245019.1
XM_005244963.1	985	Intron			XP_005245020.1

Gene: LOC105371451
Gene Name: uncharacterized LOC105371451

There are no transcripts associated with this gene.

Gene: RUSC1
Gene Name: RUN and SH3 domain containing 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001105203.1	985	Intron			NP_001098673.1
NM_001105204.1	985	Intron			NP_001098674.1
NM_001105205.1	985	Intron			NP_001098675.1
NM_001278227.1	985	Intron			NP_001265156.1
NM_001278228.1	985	Intron			NP_001265157.1
NM_001278229.1	985	Intron			NP_001265158.1
NM_001278230.1	985	Intron			NP_001265159.1
NM_014328.4	985	Intron			NP_055143.2
XM_006711254.1	985	Intron			XP_006711317.1
XM_006711256.1	985	Intron			XP_006711319.1
XM_006711257.1	985	Intron			XP_006711320.1
XM_017000891.1	985	Intron			XP_016856380.1
XM_017000892.1	985	Intron			XP_016856381.1

Gene: RUSC1-AS1
Gene Name: RUSC1 antisense RNA 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001039517.1	985	Silent Mutation	TCA,TCC	S236S	NP_001034606.1

View Full Product Details