Product Details
- SNP ID
-
rs12828980
- Assay Type
- Functionally Tested
- NCBI dbSNP Submissions
-
NA
- Location
-
Chr.12:48858718 on Build GRCh38
- Set Membership
-
- Context Sequence [VIC/FAM]
- TAAAGATAATAAAATAATAATAAAC[A/C]CTTTTAAAAAATGTTTAAAAATTCA
- Phenotype
-
MIM: 612172
MIM: 609038
- Polymorphism
- A/C, Transversion Substitution
- Allele Nomenclature
-
- Literature Links
-
DDX23
PubMed Links
- Additional Information
-
For this assay, SNP(s) [rs147079309] are located under a probe sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.
Gene Details
- Gene
- DDX23
- Gene Name
- DEAD-box helicase 23
There are no transcripts associated with this gene.
- Gene
- RND1
- Gene Name
- Rho family GTPase 1
Transcript Accession |
SNP Location |
SNP Type |
Codon Change |
Amino Acid Change |
Protein ID |
NM_014470.3 |
|
Intron |
|
|
NP_055285.1 |
View Full Product Details