Product Details
- SNP ID
-
rs12065986
- Assay Type
- Functionally Tested
- NCBI dbSNP Submissions
-
1
- Location
-
Chr.1:240008041 on Build GRCh38
- Set Membership
-
- Context Sequence [VIC/FAM]
- AGGACTGAGAGGGTCTTTGGGGAGG[G/T]TGCTTAGGTGGAACTGACACAGCTG
- Phenotype
-
MIM: 606373
- Polymorphism
- G/T, Transversion Substitution
- Allele Nomenclature
-
- Literature Links
-
FMN2
PubMed Links
- Additional Information
-
For this assay, SNP(s) [rs112000345] are located under a probe sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.
Gene Details
- Gene
- FMN2
- Gene Name
- formin 2
There are no transcripts associated with this gene.
- Gene
- RPS7P5
- Gene Name
- ribosomal protein S7 pseudogene 5
There are no transcripts associated with this gene.
View Full Product Details