Product Details

SNP ID: rs4635255
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.14:58417770 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: CCCAATGAAGGAAATAAAGAGCAGA[A/G]ATCAATTTAAATGAAAAGAGAAAAA
Phenotype: MIM: 610178 MIM: 607384
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: KIAA0586 PubMed Links

Gene Details

Gene: KIAA0586
Gene Name: KIAA0586

There are no transcripts associated with this gene.

Gene: TIMM9
Gene Name: translocase of inner mitochondrial membrane 9

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001304485.1		Intron			NP_001291414.1
NM_001304486.1		Intron			NP_001291415.1
NM_001304487.1		Intron			NP_001291416.1
NM_001304488.1		Intron			NP_001291417.1
NM_001304489.1		Intron			NP_001291418.1
NM_001304490.1		Intron			NP_001291419.1
NM_001304491.1		Intron			NP_001291420.1
NM_012460.3		Intron			NP_036592.1

Gene: TOMM20L
Gene Name: translocase of outer mitochondrial membrane 20 like

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_207377.2		Intron			NP_997260.1
XM_011536742.2		Intron			XP_011535044.1
XM_011536743.2		Intron			XP_011535045.1
XM_011536744.2		Intron			XP_011535046.1

View Full Product Details