Product Details

SNP ID: rs3793023
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.6:43015021 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: GTTGTTTATATGGCAGAGAAACTAA[A/C]ATTTTTTTTCTCCACCTTTGGCTGG
Phenotype: MIM: 611248 MIM: 143170 MIM: 601646 MIM: 613475
Polymorphism: A/C, Transversion substitution
Allele Nomenclature
Literature Links: KLHDC3 PubMed Links

Gene Details

Gene: KLHDC3
Gene Name: kelch domain containing 3

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_057161.3		Intron			NP_476502.1

Gene: MEA1
Gene Name: male-enhanced antigen 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001318942.1		Intron			NP_001305871.1
NM_001318943.1		Intron			NP_001305872.1
NM_014623.3		Intron			NP_055438.1
XM_005249121.3		Intron			XP_005249178.1
XM_017010868.1		Intron			XP_016866357.1

Gene: PPP2R5D
Gene Name: protein phosphatase 2 regulatory subunit B'delta

There are no transcripts associated with this gene.

Gene: RRP36
Gene Name: ribosomal RNA processing 36

There are no transcripts associated with this gene.

View Full Product Details