Product Details

SNP ID: rs1044395
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.19:48329461 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: ACACCATGCGACGAGGAGGTCTCTT[C/T]TATGCCACCGGCCTCTGCCAGCTTT
Phenotype: MIM: 615038 MIM: 602335
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: CCDC114 PubMed Links

Gene Details

Gene: CCDC114
Gene Name: coiled-coil domain containing 114

There are no transcripts associated with this gene.

Gene: EMP3
Gene Name: epithelial membrane protein 3

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001313905.1	476	Silent Mutation	TTC,TTT	F97F	NP_001300834.1
NM_001425.2	476	Silent Mutation	TTC,TTT	F97F	NP_001416.1
XM_011526605.2	476	Silent Mutation	TTC,TTT	F97F	XP_011524907.1

Gene: TMEM143
Gene Name: transmembrane protein 143

There are no transcripts associated with this gene.

View Full Product Details