Product Details
- SNP ID
-
rs121964879
- Assay Type
- Functionally Tested
- NCBI dbSNP Submissions
-
NA
- Location
-
Chr.2:70936045 on Build GRCh38
- Set Membership
-
- Context Sequence [VIC/FAM]
- CCGAGAACACATGCAGGCGGTCACC[C/T]GAAACTACATCACCCACCCCCGTGT
- Phenotype
-
MIM: 192132
MIM: 604295
- Polymorphism
- C/T, Transition Substitution
- Allele Nomenclature
-
- Literature Links
-
ATP6V1B1
PubMed Links
- Additional Information
-
For this assay, SNP(s) [rs17720303] are located under a probe sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.
Gene Details
- Gene
- ATP6V1B1
- Gene Name
- ATPase H+ transporting V1 subunit B1
- Gene
- ATP6V1B1-AS1
- Gene Name
- ATP6V1B1 antisense RNA 1
There are no transcripts associated with this gene.
- Gene
- VAX2
- Gene Name
- ventral anterior homeobox 2
There are no transcripts associated with this gene.
View Full Product Details