Product Details
- SNP ID
-
rs17115115
- Assay Type
- Functionally Tested
- NCBI dbSNP Submissions
-
NA
- Location
-
Chr.15:25057329 on Build GRCh38
- Set Membership
-
HapMap
- Context Sequence [VIC/FAM]
- AGACCTTGGTCTTGATTTTCAGTTA[C/T]CTGAGGAGAGGGGAGTGCCAAAGTG
- Phenotype
-
MIM: 605436
- Polymorphism
- C/T, Transition Substitution
- Allele Nomenclature
-
- Literature Links
-
SNORD116-1
PubMed Links
- Additional Information
-
For this assay, SNP(s) [rs79048823] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.
Gene Details
- Gene
- SNORD116-1
- Gene Name
- small nucleolar RNA, C/D box 116-1
There are no transcripts associated with this gene.
- Gene
- SNORD116-2
- Gene Name
- small nucleolar RNA, C/D box 116-2
There are no transcripts associated with this gene.
- Gene
- SNORD116-3
- Gene Name
- small nucleolar RNA, C/D box 116-3
There are no transcripts associated with this gene.
- Gene
- SNORD116-4
- Gene Name
- small nucleolar RNA, C/D box 116-4
There are no transcripts associated with this gene.
- Gene
- SNORD116-5
- Gene Name
- small nucleolar RNA, C/D box 116-5
There are no transcripts associated with this gene.
- Gene
- SNORD116-6
- Gene Name
- small nucleolar RNA, C/D box 116-6
There are no transcripts associated with this gene.
- Gene
- SNORD116@
- Gene Name
- small nucleolar RNA, C/D box 116 cluster
There are no transcripts associated with this gene.
View Full Product Details