Product Details

SNP ID: rs16919292
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.11:93742626 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: TTTCATATGATAAACCACAAAAATC[A/G]GTAAAGCTGTCTAGTCTTATTTTAT
Phenotype: MIM: 615810 MIM: 612823
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: C11orf54 PubMed Links

Gene Details

Gene: C11orf54
Gene Name: chromosome 11 open reading frame 54

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001286067.1		Intron			NP_001272996.1
NM_001286068.1		Intron			NP_001272997.1
NM_001286069.1		Intron			NP_001272998.1
NM_001286070.1		Intron			NP_001272999.1
NM_001286071.1		Intron			NP_001273000.1
NM_014039.3		Intron			NP_054758.2
XM_006718824.1		Intron			XP_006718887.1
XM_011542781.2		Intron			XP_011541083.1
XM_011542782.2		Intron			XP_011541084.1
XM_017017613.1		Intron			XP_016873102.1
XM_017017614.1		Intron			XP_016873103.1
XM_017017615.1		Intron			XP_016873104.1
XM_017017616.1		Intron			XP_016873105.1
XM_017017617.1		Intron			XP_016873106.1
XM_017017618.1		Intron			XP_016873107.1
XM_017017619.1		Intron			XP_016873108.1

Gene: MIR1304
Gene Name: microRNA 1304

There are no transcripts associated with this gene.

Gene: SNORA18
Gene Name: small nucleolar RNA, H/ACA box 18

There are no transcripts associated with this gene.

Gene: SNORA40
Gene Name: small nucleolar RNA, H/ACA box 40

There are no transcripts associated with this gene.

Gene: SNORD5
Gene Name: small nucleolar RNA, C/D box 5

There are no transcripts associated with this gene.

Gene: TAF1D
Gene Name: TATA-box binding protein associated factor, RNA polymerase I subunit D

There are no transcripts associated with this gene.

View Full Product Details