Product Details

SNP ID: rs16982203
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.20:58656859 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: CCTGGCTCTGGGCTAAGCCCTTTCC[A/G]TGTGTAAGCTCAGCTCATCTTCACA
Phenotype: MIM: 603666
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: LOC107985410 PubMed Links

Gene Details

Gene: LOC107985410
Gene Name: uncharacterized LOC107985410

There are no transcripts associated with this gene.

Gene: STX16
Gene Name: syntaxin 16

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001001433.2		Intron			NP_001001433.1
NM_001134772.2		Intron			NP_001128244.1
NM_001134773.2		Intron			NP_001128245.1
NM_001204868.1		Intron			NP_001191797.1
NM_003763.5		Intron			NP_003754.2

Gene: STX16-NPEPL1
Gene Name: STX16-NPEPL1 readthrough (NMD candidate)

There are no transcripts associated with this gene.

View Full Product Details