Product Details

SNP ID: rs17855394
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.20:50936168 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CATACCTCGCCAATAGTATAATTCA[A/T]CTGTCTTGCCCGAACAATCATCTCC
Phenotype: MIM: 611386 MIM: 603503
Polymorphism: A/T, Transversion substitution
Allele Nomenclature
Literature Links: ADNP PubMed Links

Gene Details

Gene: ADNP
Gene Name: activity dependent neuroprotector homeobox

There are no transcripts associated with this gene.

Gene: ADNP-AS1
Gene Name: ADNP antisense RNA 1

There are no transcripts associated with this gene.

Gene: DPM1
Gene Name: dolichyl-phosphate mannosyltransferase polypeptide 1, catalytic subunit

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001317034.1	699	Missense Mutation	ATG,TTG	M255L	NP_001303963.1
NM_001317035.1	699	Missense Mutation	ATG,TTG	M247L	NP_001303964.1
NM_001317036.1	699	Missense Mutation	ATG,TTG	M197L	NP_001303965.1
NM_003859.2	699	Missense Mutation	ATG,TTG	M220L	NP_003850.1
XM_011529093.2	699	Intron			XP_011527395.1

View Full Product Details