Product Details

SNP ID

rs16967444

Assay Type

Functionally Tested

NCBI dbSNP Submissions

NA

Location

Chr.16:57186762 on Build GRCh38

Set Membership

Context Sequence [VIC/FAM]

GGTTCTTGGGGGTCGCCCTTCTGAG[C/G]AGGCTGCGGCTAACAGGGCCCAGGT

Phenotype

MIM: 616585

Polymorphism

C/G, Transversion Substitution

Allele Nomenclature

Literature Links

FAM192A PubMed Links

Additional Information

For this assay, SNP(s) [rs77056538] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.

Gene Details

Gene

FAM192A

Gene Name

family with sequence similarity 192 member A

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_024946.2	452	Intron			NP_079222.1
XM_005256156.4	452	Intron			XP_005256213.1
XM_005256158.3	452	Intron			XP_005256215.1
XM_005256160.2	452	Intron			XP_005256217.1
XM_005256163.2	452	Intron			XP_005256220.1
XM_005256164.3	452	Intron			XP_005256221.1
XM_005256165.2	452	Intron			XP_005256222.1
XM_006721275.3	452	Intron			XP_006721338.2
XM_011523343.2	452	Intron			XP_011521645.1
XM_017023681.1	452	Intron			XP_016879170.1
XM_017023682.1	452	Intron			XP_016879171.1
XM_017023683.1	452	Intron			XP_016879172.1
XM_017023684.1	452	Intron			XP_016879173.1
XM_017023685.1	452	Intron			XP_016879174.1
XM_017023686.1	452	Intron			XP_016879175.1
XM_017023687.1	452	Intron			XP_016879176.1
XM_017023688.1	452	Intron			XP_016879177.1
XM_017023689.1	452	Intron			XP_016879178.1
XM_017023690.1	452	Intron			XP_016879179.1
XM_017023691.1	452	Intron			XP_016879180.1
XM_017023692.1	452	Intron			XP_016879181.1
XM_017023693.1	452	Intron			XP_016879182.1
XM_017023694.1	452	Intron			XP_016879183.1
XM_017023695.1	452	Intron			XP_016879184.1
XM_017023696.1	452	Intron			XP_016879185.1
XM_017023697.1	452	Intron			XP_016879186.1
XM_017023698.1	452	Intron			XP_016879187.1
XM_017023699.1	452	Intron			XP_016879188.1
XM_017023700.1	452	Intron			XP_016879189.1
XM_017023701.1	452	Intron			XP_016879190.1
XM_017023702.1	452	Intron			XP_016879191.1
XM_017023703.1	452	Intron			XP_016879192.1
XM_017023704.1	452	Intron			XP_016879193.1

Gene

RSPRY1

Gene Name

ring finger and SPRY domain containing 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001305163.1	452	UTR 5			NP_001292092.1
NM_001305164.1	452	Intron			NP_001292093.1
NM_001305182.1	452	UTR 5			NP_001292111.1
NM_133368.2	452	Intron			NP_588609.1
XM_005256220.1	452	UTR 5			XP_005256277.1
XM_011523427.1	452	Intron			XP_011521729.1
XM_011523428.1	452	UTR 5			XP_011521730.1
XM_011523430.1	452	Intron			XP_011521732.1
XM_017023844.1	452	UTR 5			XP_016879333.1

View Full Product Details