Product Details

SNP ID: rs17018399
Assay Type: Functionally tested
NCBI dbSNP Submissions: 22
Location: Chr.1:212044248 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: CACTCTTGTTTTAAGTACTACCCTC[A/G]ATTTAGCCCTTCTCTAAATAAGAGA
Phenotype: MIM: 610617 MIM: 611350
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: DTL PubMed Links

Gene Details

Gene: DTL
Gene Name: denticleless E3 ubiquitin protein ligase homolog

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001286229.1		Intron			NP_001273158.1
NM_001286230.1		Intron			NP_001273159.1
NM_016448.3		Intron			NP_057532.3
XM_011509614.1		Intron			XP_011507916.1

Gene: INTS7
Gene Name: integrator complex subunit 7

There are no transcripts associated with this gene.

Gene: RPL21P28
Gene Name: ribosomal protein L21 pseudogene 28

There are no transcripts associated with this gene.

View Full Product Details