Product Details

SNP ID: rs7789085
Assay Type: DME
NCBI dbSNP Submissions: NA
Location: Chr.7:100875204 on Build GRCh38
Set Membership: HapMap DME Validated Inventoried
Context Sequence [VIC/FAM]: CCCACTTTTGTTCGCCTCTCTTCGG[C/T]CCTCTACTCAAGAGCTCCGTCTCCG
Phenotype: MIM: 616861 MIM: 614469 MIM: 602933
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: MIR6875 PubMed Links

Gene Details

Gene: MIR6875
Gene Name: microRNA 6875

There are no transcripts associated with this gene.

Gene: SLC12A9
Gene Name: solute carrier family 12 member 9

There are no transcripts associated with this gene.

Gene: SRRT
Gene Name: serrate, RNA effector molecule

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001128852.1	126	UTR 5			NP_001122324.1
NM_001128853.1	126	UTR 5			NP_001122325.1
NM_001128854.1	126	UTR 5			NP_001122326.1
NM_015908.5	126	UTR 5			NP_056992.4
XM_005250405.2	126	Intron			XP_005250462.1
XM_005250406.2	126	Intron			XP_005250463.1
XM_005250407.2	126	Intron			XP_005250464.1
XM_005250408.2	126	Intron			XP_005250465.1
XM_017012290.1	126	UTR 5			XP_016867779.1
XM_017012291.1	126	UTR 5			XP_016867780.1

Gene: TRIP6
Gene Name: thyroid hormone receptor interactor 6

There are no transcripts associated with this gene.

View Full Product Details