Product Details

SNP ID: rs17857027
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.15:55359836 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: ATCCATCCTTATAGGATTCACCACT[A/G]TGTTAAAAAGGCTCATGGACTCTTG
Phenotype: MIM: 611326 MIM: 604122
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: CCPG1 PubMed Links

Gene Details

Gene: CCPG1
Gene Name: cell cycle progression 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001204450.1	2476	Missense Mutation			NP_001191379.1
NM_001204451.1	2476	Intron			NP_001191380.1
NM_004748.4	2476	Missense Mutation			NP_004739.3
NM_020739.3	2476	Missense Mutation			NP_065790.2

Gene: DYX1C1-CCPG1
Gene Name: DYX1C1-CCPG1 readthrough (NMD candidate)

There are no transcripts associated with this gene.

Gene: PIGB
Gene Name: phosphatidylinositol glycan anchor biosynthesis class B

There are no transcripts associated with this gene.

View Full Product Details