Product Details
- SNP ID
-
rs16911867
- Assay Type
- Functionally Tested
- NCBI dbSNP Submissions
-
NA
- Location
-
Chr.9:122526804 on Build GRCh38
- Set Membership
-
HapMap
- Context Sequence [VIC/FAM]
- ATTTCCCCAGTCACACAGAAGGACA[A/G]CCGAGCCATGAGGAACGTGTGAGTC
- Phenotype
-
- Polymorphism
- A/G, Transition Substitution
- Allele Nomenclature
-
- Literature Links
-
OR1J4
PubMed Links
- Additional Information
-
For this assay, SNP(s) [rs147007481,rs79694982] are located under a probe sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.
Gene Details
- Gene
- OR1J4
- Gene Name
- olfactory receptor family 1 subfamily J member 4
There are no transcripts associated with this gene.
- Gene
- OR1N1
- Gene Name
- olfactory receptor family 1 subfamily N member 1
| Transcript Accession |
SNP Location |
SNP Type |
Codon Change |
Amino Acid Change |
Protein ID |
| NM_012363.1 |
|
Intron |
|
|
NP_036495.1 |
View Full Product Details