Product Details

SNP ID
rs16823360
Assay Type
Functionally Tested
NCBI dbSNP Submissions
NA
Location
Chr.2:143951776 on Build GRCh38
Set Membership
HapMap
Context Sequence [VIC/FAM]
CAGTAAATTTTAAAAAAGCATGTAC[C/T]GTGCATTAAGTGCACGTATTTCATA
Phenotype
MIM: 610165
Polymorphism
C/T, Transition Substitution
Allele Nomenclature
Literature Links
GTDC1 PubMed Links
Additional Information
For this assay, SNP(s) [rs114717712] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.

Gene Details

Gene
GTDC1
Gene Name
glycosyltransferase like domain containing 1
Transcript Accession SNP Location SNP Type Codon Change Amino Acid Change Protein ID
NM_001006636.3 Intron NP_001006637.1
NM_001164629.3 Intron NP_001158101.1
NM_001284233.1 Intron NP_001271162.1
NM_001284234.1 Intron NP_001271163.1
NM_001284235.1 Intron NP_001271164.1
NM_001284238.1 Intron NP_001271167.1
NM_024659.4 Intron NP_078935.2
XM_005263774.2 Intron XP_005263831.1
XM_005263782.2 Intron XP_005263839.1
XM_005263784.2 Intron XP_005263841.1
XM_011511843.2 Intron XP_011510145.1
XM_011511855.2 Intron XP_011510157.1
XM_011511856.2 Intron XP_011510158.1
XM_017004917.1 Intron XP_016860406.1
XM_017004918.1 Intron XP_016860407.1
XM_017004919.1 Intron XP_016860408.1
XM_017004920.1 Intron XP_016860409.1
XM_017004921.1 Intron XP_016860410.1
XM_017004922.1 Intron XP_016860411.1
XM_017004923.1 Intron XP_016860412.1
XM_017004924.1 Intron XP_016860413.1
XM_017004925.1 Intron XP_016860414.1
XM_017004926.1 Intron XP_016860415.1
XM_017004927.1 Intron XP_016860416.1
XM_017004928.1 Intron XP_016860417.1
XM_017004929.1 Intron XP_016860418.1
XM_017004930.1 Intron XP_016860419.1
XM_017004931.1 Intron XP_016860420.1
XM_017004932.1 Intron XP_016860421.1
XM_017004933.1 Intron XP_016860422.1
XM_017004934.1 Intron XP_016860423.1
XM_017004935.1 Intron XP_016860424.1
XM_017004936.1 Intron XP_016860425.1
XM_017004937.1 Intron XP_016860426.1
XM_017004938.1 Intron XP_016860427.1
XM_017004939.1 Intron XP_016860428.1
XM_017004940.1 Intron XP_016860429.1
XM_017004941.1 Intron XP_016860430.1
XM_017004942.1 Intron XP_016860431.1
XM_017004943.1 Intron XP_016860432.1
XM_017004944.1 Intron XP_016860433.1
XM_017004945.1 Intron XP_016860434.1
XM_017004946.1 Intron XP_016860435.1
XM_017004947.1 Intron XP_016860436.1
XM_017004948.1 Intron XP_016860437.1
XM_017004949.1 Intron XP_016860438.1
XM_017004950.1 Intron XP_016860439.1
XM_017004951.1 Intron XP_016860440.1
XM_017004952.1 Intron XP_016860441.1
XM_017004953.1 Intron XP_016860442.1
XM_017004954.1 Intron XP_016860443.1
XM_017004955.1 Intron XP_016860444.1
XM_017004956.1 Intron XP_016860445.1
XM_017004957.1 Intron XP_016860446.1
Gene
LOC101928386
Gene Name
uncharacterized LOC101928386
There are no transcripts associated with this gene.

View Full Product Details