Product Details

SNP ID: rs955955
Assay Type: Functionally tested
NCBI dbSNP Submissions: 38
Location: Chr.1:151039067 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: GAGGACTCAGCTGGTAGAAGTAGAG[A/G]CTAGAGCTAAAGGATCAGGATGGAC
Phenotype: MIM: 611275
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: BNIPL PubMed Links

Gene Details

Gene: BNIPL
Gene Name: BCL2 interacting protein like

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001159642.1		Intron			NP_001153114.1
NM_138278.3		Intron			NP_612122.2
XM_011509236.1		Intron			XP_011507538.1
XM_017000420.1		Intron			XP_016855909.1

Gene: C1orf56
Gene Name: chromosome 1 open reading frame 56

There are no transcripts associated with this gene.

Gene: PRUNE1
Gene Name: prune exopolyphosphatase

There are no transcripts associated with this gene.

View Full Product Details