Product Details

SNP ID: rs6769292
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.3:126437520 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: AAGGTGATCACCTTGTCTCCTTTTA[C/T]AAGACAGACCTCACTCGGTAAAAAT
Phenotype: MIM: 615746
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: CFAP100 PubMed Links

Gene Details

Gene: CFAP100
Gene Name: cilia and flagella associated protein 100

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_182628.2	3231	Intron			NP_872434.2
XM_006713623.2	3231	Intron			XP_006713686.1
XM_017006320.1	3231	Intron			XP_016861809.1
XM_017006321.1	3231	Intron			XP_016861810.1
XM_017006322.1	3231	Intron			XP_016861811.1
XM_017006323.1	3231	Intron			XP_016861812.1
XM_017006324.1	3231	Intron			XP_016861813.1
XM_017006325.1	3231	Intron			XP_016861814.1
XM_017006326.1	3231	Intron			XP_016861815.1
XM_017006327.1	3231	Intron			XP_016861816.1

Gene: LOC105374089
Gene Name: uncharacterized LOC105374089

There are no transcripts associated with this gene.

Gene: ZXDC
Gene Name: ZXD family zinc finger C

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001040653.3	3231	Intron			NP_001035743.1
NM_025112.4	3231	Intron			NP_079388.3
XM_005247757.3	3231	Intron			XP_005247814.1
XM_006713741.2	3231	UTR 3			XP_006713804.1
XM_011513119.2	3231	UTR 3			XP_011511421.1

View Full Product Details