Product Details

SNP ID: rs11542610
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.3:129170478 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: TTAGGCTGTAGCCTCAATTGTGCAT[A/T]CCCGTGCAAGGTGCCCTGACTCGCC
Phenotype: MIM: 116955 MIM: 612764
Polymorphism: A/T, Transversion substitution
Allele Nomenclature
Literature Links: CNBP PubMed Links

Gene Details

Gene: CNBP
Gene Name: CCHC-type zinc finger nucleic acid binding protein

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001127192.1	718	Missense Mutation	GAA,GTA	E172V	NP_001120664.1
NM_001127193.1	718	Missense Mutation	GAA,GTA	E171V	NP_001120665.1
NM_001127194.1	718	Missense Mutation	GAA,GTA	E165V	NP_001120666.1
NM_001127195.1	718	Missense Mutation	GAA,GTA	E164V	NP_001120667.1
NM_001127196.1	718	Missense Mutation	GAA,GTA	E163V	NP_001120668.1
NM_003418.4	718	Missense Mutation	GAA,GTA	E170V	NP_003409.1

Gene: ISY1
Gene Name: ISY1 splicing factor homolog

There are no transcripts associated with this gene.

Gene: ISY1-RAB43
Gene Name: ISY1-RAB43 readthrough

There are no transcripts associated with this gene.

View Full Product Details