Product Details

SNP ID: rs7937222
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.11:6605696 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: ACTCTGGTAGGCCCCAGTGTCTGTT[A/G]CTCCCCTCAGTGTGCAGTTAGGATG
Phenotype: MIM: 602366 MIM: 615818 MIM: 600475 MIM: 607998
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: ILK PubMed Links

Gene Details

Gene: ILK
Gene Name: integrin linked kinase

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001014794.2		Intron			NP_001014794.1
NM_001014795.2		Intron			NP_001014795.1
NM_001278441.1		Intron			NP_001265370.1
NM_001278442.1		Intron			NP_001265371.1
NM_004517.3		Intron			NP_004508.1
XM_005252904.4		Intron			XP_005252961.1
XM_005252905.2		Intron			XP_005252962.1
XM_011520065.1		Intron			XP_011518367.1
XM_017017672.1		Intron			XP_016873161.1

Gene: RRP8
Gene Name: ribosomal RNA processing 8, methyltransferase, homolog (yeast)

There are no transcripts associated with this gene.

Gene: TAF10
Gene Name: TATA-box binding protein associated factor 10

There are no transcripts associated with this gene.

Gene: TPP1
Gene Name: tripeptidyl peptidase 1

There are no transcripts associated with this gene.

View Full Product Details