Product Details

SNP ID: rs11554380
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.12:110493207 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: ATTTTGAACTGTCCAACAGTCACAA[A/C]TTTCTGTTCTGGATAATTCAGATTC
Phenotype: MIM: 608368 MIM: 606932
Polymorphism: A/C, Transversion substitution
Allele Nomenclature
Literature Links: FAM216A PubMed Links

Gene Details

Gene: FAM216A
Gene Name: family with sequence similarity 216 member A

There are no transcripts associated with this gene.

Gene: RAD9B
Gene Name: RAD9 checkpoint clamp component B

There are no transcripts associated with this gene.

Gene: VPS29
Gene Name: VPS29, retromer complex component

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001282150.1	370	Missense Mutation	GTT,TTT	V106F	NP_001269079.1
NM_001282151.1	370	Intron			NP_001269080.1
NM_016226.4	370	Missense Mutation	GTT,TTT	V74F	NP_057310.1
NM_057180.2	370	Missense Mutation	GTT,TTT	V78F	NP_476528.1
XM_006719459.3	370	Missense Mutation	GTT,TTT	V75F	XP_006719522.1
XM_006719460.3	370	Missense Mutation	GTT,TTT	V75F	XP_006719523.1
XM_011538484.2	370	Missense Mutation	GTT,TTT	V75F	XP_011536786.1
XM_017019457.1	370	Missense Mutation	GTT,TTT	V106F	XP_016874946.1
XM_017019458.1	370	Missense Mutation	GTT,TTT	V75F	XP_016874947.1
XM_017019459.1	370	Intron			XP_016874948.1

View Full Product Details