Product Details

SNP ID: rs11553801
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.16:67228802 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: AGCTTTATTTCTATCCACAGGCACC[C/T]TAAGGATGTGATCCTACTGACAGCC
Phenotype: MIM: 606881
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: FHOD1 PubMed Links

Gene Details

Gene: FHOD1
Gene Name: formin homology 2 domain containing 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001318202.1	528	Intron			NP_001305131.1
NM_013241.2	528	Intron			NP_037373.2
XM_006721180.1	528	Intron			XP_006721243.1
XM_011523043.2	528	Intron			XP_011521345.1
XM_011523044.1	528	Intron			XP_011521346.1
XM_011523045.2	528	Intron			XP_011521347.1

Gene: LOC105369155
Gene Name: uncharacterized LOC105369155

There are no transcripts associated with this gene.

Gene: LRRC29
Gene Name: leucine rich repeat containing 29

There are no transcripts associated with this gene.

Gene: TMEM208
Gene Name: transmembrane protein 208

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001318217.1	528	Missense Mutation	CCT,CTT	P32L	NP_001305146.1
NM_014187.3	528	Missense Mutation	CCT,CTT	P102L	NP_054906.2

View Full Product Details