Product Details

SNP ID
rs7960601
Assay Type
Functionally Tested
NCBI dbSNP Submissions
NA
Location
Chr.12:75277194 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]
ATGCTGTCATGTTAACACGTTACAT[C/T]CCAAAAGTAGCTTCCCTTTTTTTTT
Phenotype
MIM: 607724
Polymorphism
C/T, Transition Substitution
Allele Nomenclature
Literature Links
CAPS2 PubMed Links
Additional Information
For this assay, SNP(s) [rs115326793] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.

Gene Details

Gene
CAPS2
Gene Name
calcyphosine 2
Transcript Accession SNP Location SNP Type Codon Change Amino Acid Change Protein ID
NM_001286547.1 3591 Intron NP_001273476.1
NM_001286548.1 3591 Intron NP_001273477.1
NM_001286549.1 3591 Intron NP_001273478.1
NM_032606.3 3591 Intron NP_115995.2
XM_005269192.1 3591 UTR 3 XP_005269249.1
XM_005269194.3 3591 Intron XP_005269251.1
XM_006719648.2 3591 UTR 3 XP_006719711.2
XM_006719649.2 3591 UTR 3 XP_006719712.2
XM_011538878.1 3591 UTR 3 XP_011537180.1
XM_011538886.2 3591 UTR 3 XP_011537188.1
XM_011538887.2 3591 UTR 3 XP_011537189.1
XM_011538888.1 3591 UTR 3 XP_011537190.1
XM_011538889.2 3591 UTR 3 XP_011537191.1
XM_011538890.1 3591 Intron XP_011537192.1
XM_011538892.1 3591 UTR 3 XP_011537194.1
XM_017020034.1 3591 UTR 3 XP_016875523.1
XM_017020035.1 3591 UTR 3 XP_016875524.1
XM_017020036.1 3591 UTR 3 XP_016875525.1
XM_017020037.1 3591 UTR 3 XP_016875526.1
XM_017020038.1 3591 UTR 3 XP_016875527.1
XM_017020039.1 3591 UTR 3 XP_016875528.1
XM_017020040.1 3591 UTR 3 XP_016875529.1
XM_017020041.1 3591 UTR 3 XP_016875530.1
XM_017020042.1 3591 UTR 3 XP_016875531.1
XM_017020043.1 3591 UTR 3 XP_016875532.1
XM_017020044.1 3591 UTR 3 XP_016875533.1
XM_017020045.1 3591 UTR 3 XP_016875534.1
XM_017020046.1 3591 UTR 3 XP_016875535.1
XM_017020047.1 3591 UTR 3 XP_016875536.1

View Full Product Details