Product Details

SNP ID: rs11553297
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.10:101787455 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: TTTTGTGAATGTCCATCTTTATCAG[A/G]GAAGGGAAATTAGCAAGGAAAGTTT
Phenotype: MIM: 600483 MIM: 604039 MIM: 606456
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: FGF8 PubMed Links

Gene Details

Gene: FGF8
Gene Name: fibroblast growth factor 8

There are no transcripts associated with this gene.

Gene: MGEA5
Gene Name: meningioma expressed antigen 5 (hyaluronidase)

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001142434.1	3343	Silent Mutation	TCC,TCT	S788S	NP_001135906.1
NM_012215.3	3343	Silent Mutation	TCC,TCT	S841S	NP_036347.1
XM_017015585.1	3343	Silent Mutation	TCC,TCT	S726S	XP_016871074.1
XM_017015586.1	3343	Silent Mutation	TCC,TCT	S703S	XP_016871075.1

Gene: NPM3
Gene Name: nucleophosmin/nucleoplasmin 3

There are no transcripts associated with this gene.

View Full Product Details