Product Details

SNP ID: rs7929180
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.11:77880557 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CTCCAGATGAATCTCCCACTTAGGG[A/T]GGAATCAAAATAGGTACCTATATCT
Phenotype: MIM: 611348 MIM: 608522
Polymorphism: A/T, Transversion substitution
Allele Nomenclature
Literature Links: AAMDC PubMed Links

Gene Details

Gene: AAMDC
Gene Name: adipogenesis associated Mth938 domain containing

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001316957.1		Intron			NP_001303886.1
NM_001316958.1		Intron			NP_001303887.1
NM_001316960.1		Intron			NP_001303889.1
NM_001316961.1		Intron			NP_001303890.1
NM_001316962.1		Intron			NP_001303891.1
NM_024684.3		Intron			NP_078960.1
XM_011544968.2		Intron			XP_011543270.1
XM_011544969.2		Intron			XP_011543271.1
XM_017017620.1		Intron			XP_016873109.1

Gene: INTS4
Gene Name: integrator complex subunit 4

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_033547.3		Intron			NP_291025.3
XM_011545352.2		Intron			XP_011543654.1
XM_011545353.2		Intron			XP_011543655.1
XM_017018560.1		Intron			XP_016874049.1

Gene: RSF1
Gene Name: remodeling and spacing factor 1

There are no transcripts associated with this gene.

View Full Product Details