Product Details

SNP ID
rs4786664
Assay Type
Functionally Tested
NCBI dbSNP Submissions
NA
Location
Chr.16:5299134 on Build GRCh38
Set Membership
HapMap
Context Sequence [VIC/FAM]
ACTGTTCTAACAATTTCCATCACAA[G/T]AAATTAAATTTGCCACTTCTTGGGC
Phenotype
MIM: 605104
Polymorphism
G/T, Transversion Substitution
Allele Nomenclature
Literature Links
RBFOX1 PubMed Links
Additional Information
For this assay, SNP(s) [rs115067305] are located under a probe and SNP(s) [rs115883086] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.

Gene Details

Gene
RBFOX1
Gene Name
RNA binding protein, fox-1 homolog 1
Transcript Accession SNP Location SNP Type Codon Change Amino Acid Change Protein ID
NM_001142333.1 Intron NP_001135805.1
NM_001142334.1 Intron NP_001135806.1
NM_001308117.1 Intron NP_001295046.1
NM_018723.3 Intron NP_061193.2
NM_145891.2 Intron NP_665898.1
NM_145892.2 Intron NP_665899.1
NM_145893.2 Intron NP_665900.1
XM_005255386.3 Intron XP_005255443.1
XM_005255387.3 Intron XP_005255444.1
XM_005255388.4 Intron XP_005255445.1
XM_005255390.3 Intron XP_005255447.1
XM_005255391.3 Intron XP_005255448.1
XM_005255394.4 Intron XP_005255451.1
XM_011522546.2 Intron XP_011520848.1
XM_011522547.2 Intron XP_011520849.1
XM_011522548.2 Intron XP_011520850.1
XM_017023318.1 Intron XP_016878807.1
XM_017023319.1 Intron XP_016878808.1
XM_017023320.1 Intron XP_016878809.1
XM_017023321.1 Intron XP_016878810.1
XM_017023322.1 Intron XP_016878811.1
XM_017023323.1 Intron XP_016878812.1
XM_017023324.1 Intron XP_016878813.1
XM_017023325.1 Intron XP_016878814.1
XM_017023326.1 Intron XP_016878815.1
XM_017023327.1 Intron XP_016878816.1
XM_017023328.1 Intron XP_016878817.1
XM_017023329.1 Intron XP_016878818.1
XM_017023330.1 Intron XP_016878819.1
XM_017023331.1 Intron XP_016878820.1
XM_017023332.1 Intron XP_016878821.1
XM_017023333.1 Intron XP_016878822.1
XM_017023334.1 Intron XP_016878823.1
XM_017023335.1 Intron XP_016878824.1
XM_017023336.1 Intron XP_016878825.1
XM_017023337.1 Intron XP_016878826.1
XM_017023338.1 Intron XP_016878827.1
XM_017023339.1 Intron XP_016878828.1
XM_017023340.1 Intron XP_016878829.1
XM_017023341.1 Intron XP_016878830.1
XM_017023342.1 Intron XP_016878831.1
XM_017023343.1 Intron XP_016878832.1

View Full Product Details