Product Details

SNP ID: rs4970429
Assay Type: Functionally tested
NCBI dbSNP Submissions: 38
Location: Chr.1:975523 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CCACAGACCCCCACCCTGCAGGGGC[C/T]GCTGCACTGGGGAGGGGCAGGCAGA
Phenotype: MIM: 615921
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: KLHL17 PubMed Links

Gene Details

Gene: KLHL17
Gene Name: kelch like family member 17

There are no transcripts associated with this gene.

Gene: PERM1
Gene Name: PPARGC1 and ESRR induced regulator, muscle 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001291366.1	2740	UTR 3			NP_001278295.1
NM_001291367.1	2740	UTR 3			NP_001278296.1
XM_017002583.1	2740	UTR 3			XP_016858072.1
XM_017002584.1	2740	UTR 3			XP_016858073.1
XM_017002585.1	2740	UTR 3			XP_016858074.1

Gene: PLEKHN1
Gene Name: pleckstrin homology domain containing N1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001160184.1	2740	Intron			NP_001153656.1
NM_032129.2	2740	Intron			NP_115505.2
XM_006710944.3	2740	Intron			XP_006711007.2
XM_011542248.2	2740	Intron			XP_011540550.2
XM_017002474.1	2740	Intron			XP_016857963.1
XM_017002475.1	2740	Intron			XP_016857964.1
XM_017002476.1	2740	Intron			XP_016857965.1
XM_017002477.1	2740	Intron			XP_016857966.1
XM_017002478.1	2740	Intron			XP_016857967.1
XM_017002479.1	2740	Intron			XP_016857968.1

View Full Product Details