Product Details

SNP ID: rs28633922
Assay Type: Functionally tested
NCBI dbSNP Submissions: 28
Location: Chr.1:153619722 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: AACCAAAAAGTTGACTGTTGAACAA[C/T]AGTTCAACATCAAACCAGAGAAGGG
Phenotype: MIM: 176940 MIM: 601989 MIM: 607986
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: S100A1 PubMed Links

Gene Details

Gene: S100A1
Gene Name: S100 calcium binding protein A1

There are no transcripts associated with this gene.

Gene: S100A13
Gene Name: S100 calcium binding protein A13

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001024210.1		Intron			NP_001019381.1
NM_001024211.1		Intron			NP_001019382.1
NM_001024212.1		Intron			NP_001019383.1
NM_001024213.1		Intron			NP_001019384.1
NM_005979.2		Intron			NP_005970.1
XM_005245434.3		Intron			XP_005245491.1
XM_011509862.2		Intron			XP_011508164.1
XM_011509863.2		Intron			XP_011508165.1
XM_011509864.1		Intron			XP_011508166.1
XM_017002034.1		Intron			XP_016857523.1
XM_017002035.1		Intron			XP_016857524.1
XM_017002036.1		Intron			XP_016857525.1

Gene: S100A14
Gene Name: S100 calcium binding protein A14

There are no transcripts associated with this gene.

Gene: S100A16
Gene Name: S100 calcium binding protein A16

There are no transcripts associated with this gene.

View Full Product Details