Product Details

SNP ID

rs3206519

Assay Type

Functionally Tested

NCBI dbSNP Submissions

NA

Location

Chr.6:83151635 on Build GRCh38

Set Membership

Context Sequence [VIC/FAM]

TTATGAAAAACCCTAGTTTGGAAAA[A/T]AAAAAAGACCAAAGAGACCTTCAGG

Phenotype

MIM: 616823 MIM: 172100

Polymorphism

A/T, Transversion Substitution

Allele Nomenclature

Literature Links

DOPEY1 PubMed Links

Additional Information

For this assay, SNP(s) [rs143938814] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.

Gene Details

Gene

DOPEY1

Gene Name

dopey family member 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001199942.1	6108	Missense Mutation	AAA,AAT	K1951N	NP_001186871.1
NM_015018.3	6108	Missense Mutation	AAA,AAT	K1960N	NP_055833.2
XM_011535619.2	6108	Missense Mutation	AAA,AAT	K1950N	XP_011533921.1
XM_017010559.1	6108	Missense Mutation	AAA,AAT	K1960N	XP_016866048.1
XM_017010560.1	6108	Missense Mutation	AAA,AAT	K1960N	XP_016866049.1
XM_017010561.1	6108	Missense Mutation	AAA,AAT	K1951N	XP_016866050.1
XM_017010562.1	6108	Missense Mutation	AAA,AAT	K1951N	XP_016866051.1
XM_017010563.1	6108	Missense Mutation	AAA,AAT	K1960N	XP_016866052.1
XM_017010564.1	6108	Missense Mutation	AAA,AAT	K1960N	XP_016866053.1
XM_017010565.1	6108	Missense Mutation	AAA,AAT	K1951N	XP_016866054.1
XM_017010566.1	6108	Missense Mutation	AAA,AAT	K1951N	XP_016866055.1
XM_017010567.1	6108	Missense Mutation	AAA,AAT	K1951N	XP_016866056.1
XM_017010568.1	6108	Missense Mutation	AAA,AAT	K1950N	XP_016866057.1
XM_017010569.1	6108	Missense Mutation	AAA,AAT	K1950N	XP_016866058.1
XM_017010570.1	6108	Missense Mutation	AAA,AAT	K1927N	XP_016866059.1
XM_017010571.1	6108	Missense Mutation	AAA,AAT	K1925N	XP_016866060.1
XM_017010572.1	6108	Missense Mutation	AAA,AAT	K1960N	XP_016866061.1
XM_017010573.1	6108	Missense Mutation	AAA,AAT	K1960N	XP_016866062.1
XM_017010574.1	6108	Missense Mutation	AAA,AAT	K1960N	XP_016866063.1

Gene

PGM3

Gene Name

phosphoglucomutase 3

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001199917.1	6108	Intron			NP_001186846.1
NM_001199918.1	6108	Intron			NP_001186847.1
NM_001199919.1	6108	Intron			NP_001186848.1
NM_015599.2	6108	Intron			NP_056414.1
XM_017010935.1	6108	Intron			XP_016866424.1
XM_017010936.1	6108	Intron			XP_016866425.1
XM_017010937.1	6108	Intron			XP_016866426.1
XM_017010938.1	6108	Intron			XP_016866427.1

View Full Product Details