Product Details

SNP ID: rs28715141
Assay Type: Functionally Tested
NCBI dbSNP Submissions: NA
Location: Chr.16:69204413 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: AGGTCTTATTCCATATATGGAATAT[A/T]ATTGCTCCTCAAAAGAAAAACATGT
Phenotype: MIM: 600027
Polymorphism: A/T, Transversion Substitution
Allele Nomenclature
Literature Links: SNTB2 PubMed Links
Additional Information: For this assay, SNP(s) [rs76178191] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.

Gene Details

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_006750.3		Intron			NP_006741.1