Product Details
- SNP ID
-
rs28552447
- Assay Type
- Functionally Tested
- NCBI dbSNP Submissions
-
NA
- Location
-
Chr.19:44113140 on Build GRCh38
- Set Membership
-
- Context Sequence [VIC/FAM]
- TGTAATCCAAATGCTCTGTGGAGTC[G/T]TACACACTGGCTCCAGAAGGAGGAT
- Phenotype
-
MIM: 194555
- Polymorphism
- G/T, Transversion Substitution
- Allele Nomenclature
-
- Literature Links
-
LOC100379224
PubMed Links
- Additional Information
-
For this assay, SNP(s) [rs79118018] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.
Gene Details
- Gene
- LOC100379224
- Gene Name
- uncharacterized LOC100379224
There are no transcripts associated with this gene.
- Gene
- ZNF224
- Gene Name
- zinc finger protein 224
There are no transcripts associated with this gene.
- Gene
- ZNF225
- Gene Name
- zinc finger protein 225
View Full Product Details