Product Details

SNP ID
rs28445694
Assay Type
Functionally Tested
NCBI dbSNP Submissions
NA
Location
Chr.22:50353791 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]
ATGATAGAGGCAAGATTTGTACCCC[A/C]GGTAGTGTGACTCAAAAGCCTCTCC
Phenotype
MIM: 610877
Polymorphism
A/C, Transversion Substitution
Allele Nomenclature
Literature Links
PPP6R2 PubMed Links
Additional Information
For this assay, SNP(s) [rs111868603] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.

Gene Details

Gene
PPP6R2
Gene Name
protein phosphatase 6 regulatory subunit 2
Transcript Accession SNP Location SNP Type Codon Change Amino Acid Change Protein ID
NM_001242898.1 Intron NP_001229827.1
NM_001242899.1 Intron NP_001229828.1
NM_001242900.1 Intron NP_001229829.1
NM_014678.4 Intron NP_055493.2
XM_005261960.3 Intron XP_005262017.1
XM_006724431.2 Intron XP_006724494.1
XM_006724434.1 Intron XP_006724497.1
XM_006724435.2 Intron XP_006724498.1
XM_011530720.2 Intron XP_011529022.1
XM_011530721.2 Intron XP_011529023.1
XM_011530722.2 Intron XP_011529024.1
XM_011530723.2 Intron XP_011529025.1
XM_011530724.2 Intron XP_011529026.1
XM_011530726.2 Intron XP_011529028.1
XM_011530727.2 Intron XP_011529029.1
XM_011530728.2 Intron XP_011529030.1
XM_011530729.2 Intron XP_011529031.1
XM_011530730.2 Intron XP_011529032.1
XM_011530731.1 Intron XP_011529033.1
XM_011530732.2 Intron XP_011529034.1
XM_011530734.2 Intron XP_011529036.1
XM_011530735.2 Intron XP_011529037.1
XM_011530736.2 Intron XP_011529038.1
XM_011530737.2 Intron XP_011529039.1
XM_011530738.2 Intron XP_011529040.1
XM_011530739.2 Intron XP_011529041.1
XM_011530740.2 Intron XP_011529042.1
XM_017029116.1 Intron XP_016884605.1
XM_017029117.1 Intron XP_016884606.1
XM_017029118.1 Intron XP_016884607.1
XM_017029119.1 Intron XP_016884608.1
XM_017029120.1 Intron XP_016884609.1
XM_017029121.1 Intron XP_016884610.1
XM_017029122.1 Intron XP_016884611.1
XM_017029123.1 Intron XP_016884612.1
XM_017029124.1 Intron XP_016884613.1
XM_017029125.1 Intron XP_016884614.1
XM_017029126.1 Intron XP_016884615.1
XM_017029127.1 Intron XP_016884616.1
XM_017029128.1 Intron XP_016884617.1
XM_017029129.1 Intron XP_016884618.1
XM_017029130.1 Intron XP_016884619.1
XM_017029131.1 Intron XP_016884620.1
XM_017029132.1 Intron XP_016884621.1
XM_017029133.1 Intron XP_016884622.1
XM_017029134.1 Intron XP_016884623.1
XM_017029135.1 Intron XP_016884624.1
XM_017029136.1 Intron XP_016884625.1
XM_017029137.1 Intron XP_016884626.1
XM_017029138.1 Intron XP_016884627.1

View Full Product Details