Product Details

SNP ID: rs28475718
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.8:144051279 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: CGGAGCACGAACTAGGCGCCGTAGC[C/T]GCGTCCCCAGAACCGGGAGACTTAA
Phenotype: MIM: 614243 MIM: 610874
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: MIR6846 PubMed Links

Gene Details

Gene: MIR6846
Gene Name: microRNA 6846

There are no transcripts associated with this gene.

Gene: OPLAH
Gene Name: 5-oxoprolinase (ATP-hydrolysing)

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_017570.4	4018	UTR 3			NP_060040.1
XM_011516960.1	4018	UTR 3			XP_011515262.1

Gene: SMPD5
Gene Name: sphingomyelin phosphodiesterase 5

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
XM_017014128.1	4018	Intron			XP_016869617.1

Gene: SPATC1
Gene Name: spermatogenesis and centriole associated 1

There are no transcripts associated with this gene.

View Full Product Details