Product Details
- SNP ID
-
rs61741408
- Assay Type
- Functionally Tested
- NCBI dbSNP Submissions
-
NA
- Location
-
Chr.7:144050703 on Build GRCh38
- Set Membership
-
- Context Sequence [VIC/FAM]
- TCCTTTGTCCCATGCACAATGCAGA[A/C]CTTTTTATACATGGCTTTTGCTCAC
- Phenotype
-
- Polymorphism
- A/C, Transversion Substitution
- Allele Nomenclature
-
- Literature Links
-
OR2A5
PubMed Links
- Additional Information
-
For this assay, SNP(s) [rs115456618] are located under a probe and SNP(s) [rs147003252] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.
Gene Details
- Gene
- OR2A5
- Gene Name
- olfactory receptor family 2 subfamily A member 5
| Transcript Accession |
SNP Location |
SNP Type |
Codon Change |
Amino Acid Change |
Protein ID |
| NM_012365.1 |
|
Intron |
|
|
NP_036497.1 |
View Full Product Details