Product Details

SNP ID: rs62640901
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.19:44118305 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: GATGCTGGAGAACTTCAGGAACCTG[C/T]TCTCAGTGGGTGAGGACAGGCACCC
Phenotype: MIM: 194555
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: LOC100379224 PubMed Links

Gene Details

Gene: LOC100379224
Gene Name: uncharacterized LOC100379224

There are no transcripts associated with this gene.

Gene: ZNF224
Gene Name: zinc finger protein 224

There are no transcripts associated with this gene.

Gene: ZNF225
Gene Name: zinc finger protein 225

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001321685.1	574	Missense Mutation	CTC,TTC	L45F	NP_001308614.1
NM_013362.3	574	Missense Mutation	CTC,TTC	L45F	NP_037494.2
XM_005259223.3	574	Intron			XP_005259280.1
XM_011527285.2	574	Missense Mutation	CTC,TTC	L45F	XP_011525587.1
XM_011527286.2	574	Missense Mutation	CTC,TTC	L45F	XP_011525588.1

View Full Product Details