Product Details

SNP ID: rs45441492
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.17:48613415 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CGTGCGATACCTCGATTCGCCGCTT[A/G]CGAGTCAGATAGGGATTAAATAGGA
Phenotype: MIM: 142961 MIM: 142962 MIM: 142963 MIM: 142964
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: HOXB-AS3 PubMed Links

Gene Details

Gene: HOXB-AS3
Gene Name: HOXB cluster antisense RNA 3

There are no transcripts associated with this gene.

Gene: HOXB6
Gene Name: homeobox B6

There are no transcripts associated with this gene.

Gene: HOXB7
Gene Name: homeobox B7

There are no transcripts associated with this gene.

Gene: HOXB8
Gene Name: homeobox B8

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_024016.3	6070	Silent Mutation	CGC,CGT	R173R	NP_076921.1
XM_005257286.2	6070	Silent Mutation	CGC,CGT	R172R	XP_005257343.1
XM_017024564.1	6070	Silent Mutation	CGC,CGT	R173R	XP_016880053.1

Gene: HOXB9
Gene Name: homeobox B9

There are no transcripts associated with this gene.

View Full Product Details