Product Details

SNP ID: rs41307183
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.20:44752236 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CTCCCAGAGGGCCTCGGAGACACCA[C/T]AGGGGAACAGGGAGAGGGGCTCGGT
Phenotype: MIM: 607368 MIM: 611601
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: KCNK15 PubMed Links

Gene Details

Gene: KCNK15
Gene Name: potassium two pore domain channel subfamily K member 15

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_022358.3	4775	UTR 3			NP_071753.2
XM_017028003.1	4775	Intron			XP_016883492.1

Gene: KCNK15-AS1
Gene Name: KCNK15 antisense RNA 1 (head to head)

There are no transcripts associated with this gene.

Gene: RIMS4
Gene Name: regulating synaptic membrane exocytosis 4

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001205317.1	4775	UTR 3			NP_001192246.1
NM_182970.3	4775	UTR 3			NP_892015.1

View Full Product Details