Product Details

SNP ID: rs45625937
Assay Type: Functionally tested
NCBI dbSNP Submissions: 13
Location: Chr.1:6460882 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: GTCTCCAACTGCTGCACCCCATCCC[G/T]ACCCTGTCTCCGCCACCTCGCAGCC
Phenotype: MIM: 606351 MIM: 611101 MIM: 603366
Polymorphism: G/T, Transversion substitution
Allele Nomenclature
Literature Links: ESPN PubMed Links

Gene Details

Gene: ESPN
Gene Name: espin

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_031475.2	3469	UTR 3			NP_113663.2
XM_005263501.2	3469	UTR 3			XP_005263558.1
XM_011542231.1	3469	Intron			XP_011540533.1
XM_011542232.1	3469	Intron			XP_011540534.1
XM_011542233.2	3469	Intron			XP_011540535.1
XM_011542236.2	3469	Intron			XP_011540538.1
XM_011542237.1	3469	Intron			XP_011540539.1
XM_011542238.2	3469	Intron			XP_011540540.1
XM_017002433.1	3469	Intron			XP_016857922.1
XM_017002434.1	3469	Intron			XP_016857923.1

Gene: PLEKHG5
Gene Name: pleckstrin homology and RhoGEF domain containing G5

There are no transcripts associated with this gene.

Gene: TNFRSF25
Gene Name: TNF receptor superfamily member 25

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001039664.1	3469	Intron			NP_001034753.1
NM_003790.2	3469	Intron			NP_003781.1
NM_148965.1	3469	Intron			NP_683866.1
NM_148966.1	3469	Intron			NP_683867.1
NM_148967.1	3469	Intron			NP_683868.1
NM_148970.1	3469	Intron			NP_683871.1

View Full Product Details