Product Details

SNP ID: rs61531461
Assay Type: Functionally tested
NCBI dbSNP Submissions: 13
Location: Chr.1:965299 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: TTCACGTCTCTGCATCCATTCCTTC[A/G]TGTCTTTATTTAGTTGTTTATTTAT
Phenotype: MIM: 610770 MIM: 615921
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: KLHL17 PubMed Links

Gene Details

Gene: KLHL17
Gene Name: kelch like family member 17

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_198317.2	2697	UTR 3			NP_938073.1
XM_006710600.3	2697	UTR 3			XP_006710663.1
XM_006710601.3	2697	Intron			XP_006710664.1

Gene: NOC2L
Gene Name: NOC2 like nucleolar associated transcriptional repressor

There are no transcripts associated with this gene.

Gene: PERM1
Gene Name: PPARGC1 and ESRR induced regulator, muscle 1

There are no transcripts associated with this gene.

Gene: PLEKHN1
Gene Name: pleckstrin homology domain containing N1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001160184.1	2697	Intron			NP_001153656.1
NM_032129.2	2697	Intron			NP_115505.2
XM_006710944.3	2697	Intron			XP_006711007.2
XM_011542248.2	2697	Intron			XP_011540550.2
XM_017002474.1	2697	Intron			XP_016857963.1
XM_017002475.1	2697	Intron			XP_016857964.1
XM_017002476.1	2697	Intron			XP_016857965.1
XM_017002477.1	2697	Intron			XP_016857966.1
XM_017002478.1	2697	Intron			XP_016857967.1
XM_017002479.1	2697	Intron			XP_016857968.1

View Full Product Details