Product Details

SNP ID: rs59781194
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.6:53272577 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: GTAGTAGTATTAATTAGTTCATAGA[C/T]GAATTCATGAGAGGAGAGAAAGAGG
Phenotype: MIM: 611805 MIM: 603715
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: ELOVL5 PubMed Links

Gene Details

Gene: ELOVL5
Gene Name: ELOVL fatty acid elongase 5

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001242828.1		Intron			NP_001229757.1
NM_001242830.1		Intron			NP_001229759.1
NM_001242831.1		Intron			NP_001229760.1
NM_001301856.1		Intron			NP_001288785.1
NM_021814.4		Intron			NP_068586.1

Gene: GCM1
Gene Name: glial cells missing homolog 1

There are no transcripts associated with this gene.

Gene: MIR5685
Gene Name: microRNA 5685

There are no transcripts associated with this gene.

View Full Product Details