Product Details
- SNP ID
-
hCV88892107
- Assay Type
- Functionally Tested
- NCBI dbSNP Submissions
-
NA
- Location
-
Chr.7:135185707 on Build GRCh38
- Set Membership
-
- Context Sequence [VIC/FAM]
- AGAGGTTCAGTTCAGGGCCAGCAGA[A/G]CCAGGCTGGGTGGGAGGGCTGTCAC
- Phenotype
-
MIM: 616303
- Polymorphism
- A/G, Transition Substitution
- Allele Nomenclature
-
- Literature Links
-
WDR91
PubMed Links
- Additional Information
-
For this assay, SNP(s) [rs62481917] are located under a probe sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.
Gene Details
- Gene
- WDR91
- Gene Name
- WD repeat domain 91
| Transcript Accession |
SNP Location |
SNP Type |
Codon Change |
Amino Acid Change |
Protein ID |
| NM_014149.3 |
2750 |
UTR 3 |
|
|
NP_054868.3 |
View Full Product Details