Product Details

SNP ID: rs58035829
Assay Type: Functionally Tested
NCBI dbSNP Submissions: NA
Location: Chr.12:31117142 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: ACCAGTAGGCGGTTATGACCGTTAA[A/C]CTGGATCTCACTGGATCCTTCACTG
Phenotype
Polymorphism: A/C, Transversion Substitution
Allele Nomenclature
Literature Links: OVOS2 PubMed Links
Additional Information: For this assay, SNP(s) [rs59046327] are located under a probe sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.

Gene Details

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
XM_017020288.1		Intron			XP_016875777.1