Product Details

SNP ID: rs60009313
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.19:45765170 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: GAGGGCTCTGGGGGCTGGAAGTCCG[A/G]CCCTGGGGCAGGGTGTTCCGCTTAC
Phenotype: MIM: 605377 MIM: 600963
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: BHMG1 PubMed Links

Gene Details

Gene: BHMG1
Gene Name: basic helix-loop-helix and HMG-box containing 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001310124.1	2946	Intron			NP_001297053.1
XM_011527571.2	2946	Intron			XP_011525873.1
XM_011527573.2	2946	Intron			XP_011525875.1
XM_011527574.2	2946	Intron			XP_011525876.1

Gene: DMPK
Gene Name: dystrophia myotonica protein kinase

There are no transcripts associated with this gene.

Gene: SIX5
Gene Name: SIX homeobox 5

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_175875.4	2946	UTR 3			NP_787071.2

View Full Product Details