Product Details

SNP ID: rs62127897
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.19:49061581 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CCTCAGCGTTATCAGCCTTGCAGCG[G/T]GTTTCAAAGAAGTACTGGCGGAGGG
Phenotype: MIM: 608826 MIM: 176268 MIM: 162662
Polymorphism: G/T, Transversion substitution
Allele Nomenclature
Literature Links: CGB7 PubMed Links

Gene Details

Gene: CGB7
Gene Name: chorionic gonadotropin beta subunit 7

There are no transcripts associated with this gene.

Gene: KCNA7
Gene Name: potassium voltage-gated channel subfamily A member 7

There are no transcripts associated with this gene.

Gene: NTF4
Gene Name: neurotrophin 4

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_006179.4	679	Silent Mutation	ACA,ACC	T139T	NP_006170.1
XM_005258962.3	679	Silent Mutation	ACA,ACC	T139T	XP_005259019.1
XM_006723232.3	679	Intron			XP_006723295.1
XM_011527008.2	679	Intron			XP_011525310.1
XM_011527009.2	679	Intron			XP_011525311.1
XM_011527010.2	679	Intron			XP_011525312.1

View Full Product Details