Product Details

SNP ID: rs59192944
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.19:49491213 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CTTATCTCACGATGGTCTGCGGATG[A/T]CCCTGTGGGAATGGCGACAATGCCA
Phenotype: MIM: 600007 MIM: 611114 MIM: 180471
Polymorphism: A/T, Transversion substitution
Allele Nomenclature
Literature Links: FLT3LG PubMed Links

Gene Details

Gene: FLT3LG
Gene Name: fms related tyrosine kinase 3 ligand

There are no transcripts associated with this gene.

Gene: MIR150
Gene Name: microRNA 150

There are no transcripts associated with this gene.

Gene: RPL13A
Gene Name: ribosomal protein L13a

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001270491.1		Intron			NP_001257420.1
NM_012423.3		Intron			NP_036555.1

Gene: RPS11
Gene Name: ribosomal protein S11

There are no transcripts associated with this gene.

Gene: SNORD32A
Gene Name: small nucleolar RNA, C/D box 32A

There are no transcripts associated with this gene.

Gene: SNORD33
Gene Name: small nucleolar RNA, C/D box 33

There are no transcripts associated with this gene.

Gene: SNORD34
Gene Name: small nucleolar RNA, C/D box 34

There are no transcripts associated with this gene.

Gene: SNORD35A
Gene Name: small nucleolar RNA, C/D box 35A

There are no transcripts associated with this gene.

Gene: SNORD35B
Gene Name: small nucleolar RNA, C/D box 35B

There are no transcripts associated with this gene.

View Full Product Details