Product Details

SNP ID

rs58466966

Assay Type

Functionally Tested

NCBI dbSNP Submissions

NA

Location

Chr.19:30225646 on Build GRCh38

Set Membership

Context Sequence [VIC/FAM]

CCGTTTACGTGCCCGAGTTTGCTCC[C/T]GACGCCCGCGTTTCAATGTTTAAGG

Phenotype

Polymorphism

C/T, Transition Substitution

Allele Nomenclature

Literature Links

ZNF536 PubMed Links

Additional Information

For this assay, SNP(s) [rs199672807,rs535519220] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.

Gene Details

Gene

ZNF536

Gene Name

zinc finger protein 536

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_014717.2	1411	Intron			NP_055532.1
XM_011527554.2	1411	UTR 5			XP_011525856.1
XM_011527555.2	1411	UTR 5			XP_011525857.1
XM_011527557.2	1411	Intron			XP_011525859.1
XM_011527558.2	1411	Intron			XP_011525860.1
XM_011527560.2	1411	Intron			XP_011525862.1
XM_017027527.1	1411	Intron			XP_016883016.1
XM_017027528.1	1411	Intron			XP_016883017.1
XM_017027529.1	1411	Intron			XP_016883018.1
XM_017027530.1	1411	Intron			XP_016883019.1
XM_017027531.1	1411	Intron			XP_016883020.1
XM_017027532.1	1411	Intron			XP_016883021.1
XM_017027533.1	1411	Intron			XP_016883022.1
XM_017027534.1	1411	Intron			XP_016883023.1
XM_017027535.1	1411	Intron			XP_016883024.1
XM_017027536.1	1411	Intron			XP_016883025.1
XM_017027537.1	1411	Intron			XP_016883026.1
XM_017027538.1	1411	Intron			XP_016883027.1
XM_017027539.1	1411	Intron			XP_016883028.1
XM_017027540.1	1411	Intron			XP_016883029.1
XM_017027541.1	1411	Intron			XP_016883030.1
XM_017027542.1	1411	Intron			XP_016883031.1
XM_017027543.1	1411	Intron			XP_016883032.1

View Full Product Details