Product Details

SNP ID

rs62135680

Assay Type

Functionally Tested

NCBI dbSNP Submissions

NA

Location

Chr.2:32947812 on Build GRCh38

Set Membership

Context Sequence [VIC/FAM]

CTGCAGGTTCACCAGAAGCAGCAGC[C/T]GCAGGGGTAAGCCCACACCCCCTTC

Phenotype

MIM: 150390

Polymorphism

C/T, Transition Substitution

Allele Nomenclature

Literature Links

LOC100271832 PubMed Links

Additional Information

For this assay, SNP(s) [rs546121967] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.

Gene Details

Gene

LOC100271832

Gene Name

uncharacterized LOC100271832

There are no transcripts associated with this gene.

Gene

LTBP1

Gene Name

latent transforming growth factor beta binding protein 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_000627.3	684	Intron			NP_000618.3
NM_001166264.1	684	Intron			NP_001159736.1
NM_001166265.1	684	Intron			NP_001159737.1
NM_001166266.1	684	Intron			NP_001159738.1
NM_206943.2	684	Missense Mutation	CCG,CTG	P163L	NP_996826.2
XM_005264317.3	684	Missense Mutation	CCG,CTG	P163L	XP_005264374.1
XM_005264318.3	684	Missense Mutation	CCG,CTG	P163L	XP_005264375.1
XM_011532853.2	684	Missense Mutation	CCG,CTG	P163L	XP_011531155.1
XM_011532855.2	684	Missense Mutation	CCG,CTG	P163L	XP_011531157.1
XM_011532856.2	684	Missense Mutation	CCG,CTG	P163L	XP_011531158.1
XM_011532857.2	684	Missense Mutation	CCG,CTG	P163L	XP_011531159.1
XM_011532858.2	684	Missense Mutation	CCG,CTG	P163L	XP_011531160.1
XM_011532859.2	684	Missense Mutation	CCG,CTG	P163L	XP_011531161.1
XM_011532860.2	684	Missense Mutation	CCG,CTG	P163L	XP_011531162.1
XM_011532861.2	684	Missense Mutation	CCG,CTG	P163L	XP_011531163.1
XM_011532862.2	684	Missense Mutation	CCG,CTG	P163L	XP_011531164.1
XM_017004108.1	684	Missense Mutation	CCG,CTG	P163L	XP_016859597.1
XM_017004109.1	684	Missense Mutation	CCG,CTG	P163L	XP_016859598.1
XM_017004110.1	684	Missense Mutation	CCG,CTG	P163L	XP_016859599.1

View Full Product Details