Product Details

SNP ID: rs55665451
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.2:27434468 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CCTTTTAGTAAGTGCTTTGCCTCCC[C/T]AGGTCATTTTTATCACAGAATACAT
Phenotype: MIM: 607386 MIM: 606010
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: IFT172 PubMed Links

Gene Details

Gene: IFT172
Gene Name: intraflagellar transport 172

There are no transcripts associated with this gene.

Gene: KRTCAP3
Gene Name: keratinocyte associated protein 3

There are no transcripts associated with this gene.

Gene: NRBP1
Gene Name: nuclear receptor binding protein 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001321357.1		Intron			NP_001308286.1
NM_001321358.1		Intron			NP_001308287.1
NM_001321359.1		Intron			NP_001308288.1
NM_001321361.1		Intron			NP_001308290.1
NM_001321362.1		Intron			NP_001308291.1
NM_001321363.1		Intron			NP_001308292.1
NM_013392.3		Intron			NP_037524.1

View Full Product Details